Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pINDUCER-21-RUNX1-P2A-ERG-IMPROVED
(Plasmid #154089)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pINDUCER-21
  • Backbone manufacturer
    Stephen Elledge, Thomas Westbrook
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Runt Related Transcription Factor 1, ETS-Related Gene
  • Alt name
    RUNX1, ERG separated by 2A peptide
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
  • Entrez Gene
    ERG (a.k.a. LMPHM14, erg-3, p55)
  • Promoter Tet on

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TCTGGGACGTCGTATGGGTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER-21-RUNX1-P2A-ERG-IMPROVED was a gift from George Daley (Addgene plasmid # 154089 ; http://n2t.net/addgene:154089 ; RRID:Addgene_154089)
  • For your References section:

    Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439