TET-pLKO.1 PURO shId2 #2
(Plasmid
#83090)
-
PurposeLentiviral shRNA vector for inducible knockdown of mouse Id2
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTet-pLKO-puro
-
Backbone manufacturerAddgene #21915
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8816
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshId2
-
gRNA/shRNA sequenceTGAGCTTATGTCGAATGATAG
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_010496
-
Entrez GeneId2 (a.k.a. Idb2, bHLHb26)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The targeting sequence was identified from the TRC ( TRCN0000218289). Knockdown validated by Western blot of transient, ectopic expression of murine Id2 in 293T cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TET-pLKO.1 PURO shId2 #2 was a gift from Kevin Janes (Addgene plasmid # 83090 ; http://n2t.net/addgene:83090 ; RRID:Addgene_83090) -
For your References section:
Tumor-Suppressor Inactivation of GDF11 Occurs by Precursor Sequestration in Triple-Negative Breast Cancer. Bajikar SS, Wang CC, Borten MA, Pereira EJ, Atkins KA, Janes KA. Dev Cell. 2017 Nov 20;43(4):418-435.e13. doi: 10.1016/j.devcel.2017.10.027. 10.1016/j.devcel.2017.10.027 PubMed 29161592