pDD286 (TagRFP^SEC^3xMyc)
(Plasmid #70684)

• Purpose: TagRFP-T^SEC^3xMyc vector with ccdB sites for cloning homology arms.
• Depositing Lab: Bob Goldstein
• Publication: FP-SEC vectors for homologous recombination in C. elegans (unpublished)

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 10500
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Growth instructions: The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TagRFP-T-C1^SEC^3xFlag
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6600
• Tags / Fusion Proteins:
  • C. elegans codon-optimized TagRFP-T
  • 3xMyc

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pDD286 is a derivative of our published TagRFP-SEC vector pDD284 (Dickinson et al. Genetics 2015, Addgene plasmid number 66825). It has a 3xMyc tag in place of 3xFlag, and Lox2272 sites in place of LoxP. These features allow pDD286 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites.