pDD283
(Plasmid #66824)

• Purpose: YPET^SEC^3xFlag vector with ccdB markers for cloning homology arms
• Depositing Lab: Bob Goldstein
• Publication: Dickinson et al Genetics. 2015 Jun 3. pii: genetics.115.178335.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 10500
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YPET-C1^SEC^3xFlag
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6600
• Tags / Fusion Proteins:
  • C. elegans codon-optimized YPET
  • 3xFlag

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.