pAAV-hSyn-eGFP-P2A-LgBiT-NLS
(Plasmid
#187834)
-
PurposeExpression of eGFP-P2A-LgBiT-NLS from human synapsin promoter via adeno-associated virus for neuronal expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4527
- Total vector size (bp) 5850
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP-P2A-LgBiT-NLS
-
Alt nameGPLN
-
Insert Size (bp)1323
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CTGCCTCAGTCTGCGGTG
- 3′ sequencing primer TGAAAGCCATACGGGAAGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-eGFP-P2A-LgBiT-NLS was a gift from William McEwan (Addgene plasmid # 187834 ; http://n2t.net/addgene:187834 ; RRID:Addgene_187834) -
For your References section:
Cholesterol determines the cytosolic entry and seeded aggregation of tau. Tuck BJ, Miller LVC, Katsinelos T, Smith AE, Wilson EL, Keeling S, Cheng S, Vaysburd MJ, Knox C, Tredgett L, Metzakopian E, James LC, McEwan WA. Cell Rep. 2022 May 3;39(5):110776. doi: 10.1016/j.celrep.2022.110776. 10.1016/j.celrep.2022.110776 PubMed 35508140