GFP-LacI-p300
(Plasmid
#179270)
-
PurposeExpresses GFP-LacI-p300 fusion plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGFP-LacI-polylinker
- Backbone size w/o insert (bp) 7304
- Total vector size (bp) 14469
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB10β cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE1A binding protein p300
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7242
-
GenBank IDNM_001429.1 NG_009817.1
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-LacI (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Acc65I (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGAAGGGCAATCAGCTGTT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-LacI-p300 was a gift from Lienhard Schmitz (Addgene plasmid # 179270 ; http://n2t.net/addgene:179270 ; RRID:Addgene_179270) -
For your References section:
Testing the Effect of Histone Acetyltransferases on Local Chromatin Compaction. Pfisterer M, Schmitz ML. Methods Mol Biol. 2023;2589:361-376. doi: 10.1007/978-1-0716-2788-4_24. 10.1007/978-1-0716-2788-4_24 PubMed 36255637