-
PurposeExpresses full length human ACE2 protein, along with TagBFP reporter and Puromycin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKLV2
-
Backbone manufacturerAddgene plasmid 67974
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2415
-
Mutationsilent mutation to remove internal EcoRI site (GAATTC to AAATTC)
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer AGCAAATGAGCAGGGAGGCATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmids 1786 and 67974
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE2 was a gift from Sriram Neelamegham (Addgene plasmid # 164219 ; http://n2t.net/addgene:164219 ; RRID:Addgene_164219) -
For your References section:
Inhibition of SARS-CoV-2 viral entry upon blocking N- and O-glycan elaboration. Yang Q, Hughes TA, Kelkar A, Yu X, Cheng K, Park S, Huang WC, Lovell JF, Neelamegham S. Elife. 2020 Oct 26;9. pii: 61552. doi: 10.7554/eLife.61552. 10.7554/eLife.61552 PubMed 33103998