pLenti-trGluc
(Plasmid
#158959)
-
PurposeDNA donor plasmid containing repair template for Gaussia luciferase (Gluc) of bioluminescent repair reporter (BLRR).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCSCW-IRES-GFP
- Backbone size w/o insert (bp) 8644
- Total vector size (bp) 9006
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametrGluc
-
Alt nametruncated Gluc
-
Alt namegibberish Gluc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)362
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCAAAATCAACGGGACTTT
- 3′ sequencing primer AACTCACAACGTGGCACTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone came from Partners Research Cores #LEN071
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-trGluc was a gift from Charles P. Lai (Addgene plasmid # 158959 ; http://n2t.net/addgene:158959 ; RRID:Addgene_158959) -
For your References section:
A multiplexed bioluminescent reporter for sensitive and non-invasive tracking of DNA double strand break repair dynamics in vitro and in vivo. Chien JC, Tabet E, Pinkham K, da Hora CC, Chang JC, Lin S, Badr CE, Lai CP. Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669. 10.1093/nar/gkaa669 PubMed 32797168