-
PurposeLentiviral plasmid for expression of far red iRFP720 nuclear marker
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLV 1-5
- Backbone size w/o insert (bp) 5902
- Total vector size (bp) 7760
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman histone H2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1868
-
Entrez GeneH2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
- Promoter hPGK
-
Tag
/ Fusion Protein
- iRFP720 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATCACCAAGTACACCAGC
- 3′ sequencing primer ATCCAGAGGTTGATTATCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-H2B-iRFP720 was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 128961 ; http://n2t.net/addgene:128961 ; RRID:Addgene_128961)