-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneSIN18
- Backbone size w/o insert (bp) 7226
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePhosphoglycerate kinase promoter
-
Alt namePGK promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)541
-
Entrez GenePGK1 (a.k.a. HEL-S-68p, MIG10, PGKA)
-
Tag
/ Fusion Protein
- H2B-eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACC CTC GCA GAC GGA CAG
- 3′ sequencing primer CTTGATGCCGTTCTTCTGCTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are several mismatches between depositor's and Addgene sequence. These mutations do not affect eGFP expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK-H2BeGFP was a gift from Mark Mercola (Addgene plasmid # 21210 ; http://n2t.net/addgene:21210 ; RRID:Addgene_21210) -
For your References section:
Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes. Kita-Matsuo H, Barcova M, Prigozhina N, Salomonis N, Wei K, Jacot JG, Nelson B, Spiering S, Haverslag R, Kim C, Talantova M, Bajpai R, Calzolari D, Terskikh A, McCulloch AD, Price JH, Conklin BR, Chen HS, Mercola M. PLoS ONE. 2009 . 4(4):e5046. 10.1371/journal.pone.0005046 PubMed 19352491