pMTgR2
(Plasmid
#107286)
-
PurposePlasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMT-BiP-V5-His
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3646
-
Vector typeInsect Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInterferon gamma receptor 2
-
Alt nameIFNgR2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)660
-
Entrez GeneIFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
- Promoter Metallothionein promoter
-
Tag
/ Fusion Protein
- CATCATCACCATCACCATGA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AGATCT (not destroyed)
- 3′ cloning site ACCGGT (not destroyed)
- 5′ sequencing primer MT Forward, CATCTCAGTGCAACTAAA (Invitrogen)
- 3′ sequencing primer BGH reverse: TAGAAGGCACAGTCGAGG (ThermoFisher) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTgR2 was a gift from Bohdan Schneider (Addgene plasmid # 107286 ; http://n2t.net/addgene:107286 ; RRID:Addgene_107286) -
For your References section:
Crystal structure of human interferon-gamma receptor 2 reveals the structural basis for receptor specificity. Mikulecky P, Zahradnik J, Kolenko P, Cerny J, Charnavets T, Kolarova L, Necasova I, Pham PN, Schneider B. Acta Crystallogr D Struct Biol. 2016 Sep;72(Pt 9):1017-25. doi: 10.1107/S2059798316012237. Epub 2016 Aug 18. 10.1107/S2059798316012237 PubMed 27599734