pcDNA3-EGFP
(Plasmid #13031)

• Purpose: Mammalian expression vector for cloning your gene fused to EGFP
• Depositing Lab: Doug Golenbock
• Publication: Fluorescent Protein Plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Enhanced Green Fluorescent Protein
• Alt name: EGFP
• Alt name: GFP
• Insert Size (bp): 700

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: GTCTTGTAGTTGCCGTCGTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: EGFP from discontinued clonetech vector.
• Articles Citing this Plasmid:
  • 200 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'