Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: lentiCRISPR
Information
- Source/Vendor
- Feng Zhang
- Alt Name
- pLentiCRISPR version 1
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- Size
- 13450
- 5' Sequencing 1 Primer
- LKO.1 5'
- 5' Sequencing 1 Primer Sequence
- GACTATCATATGCTTACCGT
- 3' Sequencing 1 Primer
- WPRE-R
- 3' Sequencing 1 Primer Sequence
- CATAGCGTAAAAGGAGCAACA
- Tag 1
- FLAG, SV40NLS
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Puromycin
- Notes
- Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
- Stable
- Stable
- Constitutive
- Unspecified
- Viral/Non-Viral
- Lentiviral