Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pFBDM
Information
- Plasmid Type
- Insect Expression
- Promoter
- Polyhedrin and p10 promoters
- Cloning Method
- Restriction Enzyme
- Size
- 5279
- 5' Sequencing 1 Primer
- p2Bac-F (for MCS1)
- 5' Sequencing 1 Primer Sequence
- ggacctttaattcaacccaacac
- 3' Sequencing 1 Primer
- TK-pA-R (for MCS1)
- 3' Sequencing 1 Primer Sequence
- TTGTCTCCTTCCGTGTTTCA
- 5' Sequencing 2 Primer
- Polyhedrin-fwd (for MCS2)
- 5' Sequencing 2 Primer Sequence
- AAATGATAACCATCTCGC
- 3' Sequencing 2 Primer
- SV40pA-R (for MCS2)
- 3' Sequencing 2 Primer Sequence
- GAAATTTGTGATGCTATTGC
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Gentamicin
- Notes
- pFBDM was derived from pFastBacDUAL (Invitrogen) and contains expression cassettes with a central multiplication module, polyhedrin (polH) and p10 promoters, two multiple cloning sites, and SV40 and HSVtk terminators. pFBDM contains transposon elements (Tn7L, Tn7R) and resistance markers for ampicillin and gentamycin. See Nat Biotechnol. 2004 Dec;22(12):1583-7 PubMed ID: 15568020 for more information.
- GenBank
- DJ417502.1
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral