Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pCDFDuet-1
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pCDFDuet™-1
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- Size
- 3781
- 5' Sequencing 1 Primer
- ACYCDuetUP1
- 5' Sequencing 1 Primer Sequence
- GGATCTCGACGCTCTCCCT
- 3' Sequencing 1 Primer
- DuetDOWN1
- 3' Sequencing 1 Primer Sequence
- GATTATGCGGCCGTGTACAA
- 5' Sequencing 2 Primer
- DuetUP2
- 5' Sequencing 2 Primer Sequence
- TTGTACACGGCCGCATAATC
- 3' Sequencing 2 Primer
- T7term
- 3' Sequencing 2 Primer Sequence
- GCTAGTTATTGCTCAGCGG
- 5' Terminal
- N-Term
- 5' Terminal 2
- N-Term
- 3' Terminal
- C-Term
- 3' Terminal 2
- C-Term
- Tag 1
- 6xHis
- Tag 2
- S15
- Bacterial Resistance
- Streptomycin
- Notes
- pCDFDuet™-1 is designed for the coexpression of two target genes. The vector encodes two multiple cloning sites (MCS) each of which is preceded by a T7 promoter, lac operator, and ribosome binding site (rbs). The vector also carries the pCloDF13 replicon, lacI gene and streptomycin/spectinomycin resistance marker. This vector can be transformed into the same cell with pETDuet™-1, pACYCDuet™-1, and pRSFDuet™-1 or pCOLADuet™-1 for the coexpression of up to eight target genes. ORFs inserted into MCS-1 can be sequenced using the ACYCDuetUP1 Primer and DuetDOWN1 Primer. ORFs inserted into MCS-2 can be sequenced using the DuetUP2 Primer and T7 Terminator Primer.
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral