Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pYES-DEST52
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Yeast Expression, Saccharomyces cerevisiae
- Induced by
- Galactose
- Promoter
- P-GAL1
- Cloning Method
- Unknown
- Size
- 7600
- 5' Sequencing 1 Primer
- GAL1
- 5' Sequencing 1 Primer Sequence
- 5'd[AATATACCTCTATACTTTAACGTC]3'
- Tag 1
- V5 (Cterm), His (Cterm)
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- URA3
- Notes
- Gateway destination vector
- Catalog Number
- 12286019
- Stable
- Unspecified
- Constitutive
- Inducible
- Viral/Non-Viral
- Nonviral