Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pTTQ18
Information
- Source/Vendor
- Michael Stark
- Plasmid Type
- Bacterial Expression
- Promoter
- Tac promoter
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 4563
- 5' Sequencing 1 Primer
- Tac promoter
- 5' Sequencing 1 Primer Sequence
- GAGCGGATAACAATTTCACACAGG
- Bacterial Resistance
- Ampicillin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral