Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pTriEx-4
Information
- Source/Vendor
- Novagen
- Alt Name
- pTriEx4
- Plasmid Type
- Mammalian expression, Bacterial Expression, Insect Expression
- Cloning Method
- Unknown
- Size
- 5238
- 5' Sequencing 1 Primer
- TriExDOWN
- 5' Sequencing 1 Primer Sequence
- TCGATCTCAGTGGTATTTGTG
- Bacterial Resistance
- Ampicillin
- Catalog Number
- EMD 70824
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified