Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pQUAST
Information
- Source/Vendor
- Christopher Potter/Liqun Luo
- Plasmid Type
- Other, expression
- Promoter
- hsp70 minimal promoter
- Cloning Method
- Unknown
- Size
- 8950
- 5' Sequencing 1 Primer
- pCasper-hs
- 5' Sequencing 1 Primer Sequence
- GCAACTACTGAAATCTGCCAAG
- Bacterial Resistance
- Ampicillin
- Catalog Number
- Addgene plasmid 24349
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified