Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pQCXIX
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Retroviral
- Promoter
- CMV/MSV
- Cloning Method
- Unknown
- Size
- 6300
- 5' Sequencing 1 Primer
- QC
- 5' Sequencing 1 Primer Sequence
- 5'd[ACGCCATCCACGCTGTTTTGACCT]3'
- Bacterial Resistance
- Ampicillin
- Notes
- Self-inactivating bicistronic retroviral vector for simultaneous expression of two genes.
- Catalog Number
- 631515
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Retroviral