Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pQCXIN
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Retroviral
- Promoter
- CMV/MSV
- Cloning Method
- Restriction Enzyme
- Size
- 7400
- 5' Sequencing 1 Primer
- QC
- 5' Sequencing 1 Primer Sequence
- 5'd[ACGCCATCCACGCTGTTTTGACCT]3'
- Tag 1
- IRES-Neo
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Neomycin
- Notes
- Self-inactivating bicistronic retroviral vector for expression of a gene together with a neomycin-resistance marker.
- Catalog Number
- 631514
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Retroviral