Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pPIC6 C
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other, Pichia pastoris
- Induced by
- Methanol
- Promoter
- AOX1
- Cloning Method
- Unknown
- Size
- 3400
- 5' Sequencing 1 Primer
- 3'AOX1
- 5' Sequencing 1 Primer Sequence
- 5'd[GCAAATGGCATTCTGACATCC]3'
- Tag 1
- Myc (Cterm), His (Cterm)
- Bacterial Resistance
- Other
- Selectable Marker
- Blasticidin
- Notes
- Expression and purification of protein from Pichia pastoris
- Catalog Number
- V21020
- Stable
- Stable
- Constitutive
- Inducible
- Viral/Non-Viral
- Nonviral