Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pMXs-GW
Information
- Alt Name
- pMXs-Gateway
- Plasmid Type
- Mammalian Expression, Retroviral
- Cloning Method
- Unknown
- 5' Sequencing 1 Primer
- 5': pBMN5'; 3': pMX-AS3200
- 5' Sequencing 1 Primer Sequence
- pMX-AS3200: TTATCGTCGACCACTGTGCTGCTG
- Bacterial Resistance
- Ampicillin
- Notes
- Note: Sequence map below is missing the Gateway cassette between bp 1938-2013. Sequence provided by Dr. Kazutoshi Takahashi and Dr. Shinya Yamanaka.
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Retroviral