Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pMSCVneo
Information
- Source/Vendor
- Clontech
- Alt Name
- MSCV neo (pmscv neo)
- Plasmid Type
- Retroviral
- Cloning Method
- Unknown
- Size
- 6500
- 5' Sequencing 1 Primer
- MSCV
- 5' Sequencing 1 Primer Sequence
- 5'd[CCCTTGAACCTCCTCGTTCGACC]3'
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Neomycin
- Notes
- Retroviral vector optimized for expression of a gene in hematopoietic, embryonic stem, or embryonic carcinoma cells.
- Catalog Number
- 634401
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Retroviral