Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pMIB/V5-His C
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other
- Promoter
- OpIE2
- Cloning Method
- Unknown
- Size
- 3600
- 5' Sequencing 1 Primer
- OpIE2
- 5' Sequencing 1 Primer Sequence
- 5'd[CGCAACGATCTGGTAAACAC]3'
- Tag 1
- HBM (N), V5 (C), His (C)
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Blasticidin
- Notes
- Stable expression of gene in insect cells. HBM tag causes protein to be secreted.
- Catalog Number
- V803001
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral