Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pLUS
Information
- Source/Vendor
- ATCC
- Plasmid Type
- Unspecified
- Cloning Method
- Unknown
- Size
- 9500
- Notes
- Vector designed to rescue the URA3 end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). Positive colonies should have the rescue plasmid integrated into the artificial chromosome near the SalI site from pYAC4 (near URA3). DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5'- CTTGAGATCGGGCGTTCGACTCGC -3' and 5'-TGAACGGTGATCCCCACCGGAATTG -3', complementary to the YAC clone and the vector respectively. Correctly integrated products will yield a 1855 bp amplification product. YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. Permits isolation of end fragments up to 20 kb. The order of the major features of the rescue vector is: T7 promoter - BamHI/polylinker/HindIII - LYS2 - EcoRI - SUP4 - SalI/YAC4 - URA3 - EcoRI - pMB1 ori - kanR. The order of the major features in a recombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/HindIII - URA end YAC insert - EcoRI - SalI/YAC4 - pMB1 ori - kanR. [1] Growth medium: LB plus kanamycin. 37C Deposited by: G.G.Hermanson Hosts: E.coli, Saccharomyces. (Information source: VectorDB ( http://seq.yeastgenome.org/vectordb ).)
- Catalog Number
- 77407
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified