Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pLenti6/V5-DEST Gateway (ViraPower)
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Lentiviral
- Promoter
- CMV, lac UV5, SV40, RSV
- Cloning Method
- Gateway Cloning
- Size
- 8687
- 5' Sequencing 1 Primer
- CMVPro Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[CGCAAATGGGCGGTAGGCGTG]3'
- 5' Terminal
- C-Term
- Tag 1
- V5
- Bacterial Resistance
- Ampicillin and Chloramphenicol
- Selectable Marker
- Blasticidin
- Notes
- Easy to clone into other vectors Lentiviral Gateway® destination vector for C-terminal tagging of a protein with a V5 epitope tag.
- Catalog Number
- V49610
- Stable
- Stable
- Constitutive
- Unspecified
- Viral/Non-Viral
- Lentiviral