Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pIB-E Echo
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other
- Promoter
- OpIE2
- Cloning Method
- Unknown
- Size
- 2500
- 5' Sequencing 1 Primer
- OpIE2
- 5' Sequencing 1 Primer Sequence
- 5'd[CGCAACGATCTGGTAAACAC]3'
- Selectable Marker
- Blasticidin
- Notes
- Stable expression of gene in insect cells. For use with Echo cloning system.
- Catalog Number
- ET32001
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral