Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pHAT 10/11/12
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Bacterial Expression
- Promoter
- lac
- Cloning Method
- Unknown
- Size
- 2800
- 5' Sequencing 1 Primer
- HAT
- 5' Sequencing 1 Primer Sequence
- 5'd[GAGGAGCACGCTCATGCCCAC]3'
- Tag 1
- HAT (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Histidine Affinity Tag (HAT) for purification
- Catalog Number
- 631205
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified