Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGL3-Control
Information
- Source/Vendor
- Promega
- Plasmid Type
- Luciferase
- Promoter
- SV40
- Cloning Method
- Unknown
- Size
- 5256
- 5' Sequencing 1 Primer
- RVprimer3
- 5' Sequencing 1 Primer Sequence
- CTAGCAAAATAGGCTGTCCC
- Bacterial Resistance
- Ampicillin
- Notes
- Luciferase Reporter Vector. For more information, see http://www.promega.com/vectors/cloning_vectors.htm#b05 Control vector with the SV40 enhancer and promoter driving strong luciferase expression.
- Catalog Number
- E1741
- GenBank
- U47296
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral