Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGEX-6P-2
Information
- Source/Vendor
- GE Healthcare Life Sciences
- Plasmid Type
- Bacterial Expression
- Promoter
- tac
- Cloning Method
- Unknown
- Size
- 4985
- 5' Sequencing 1 Primer
- pGEX Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
- Tag 1
- GST (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- PreScission cleavage site allows cleavage at low temps
- Catalog Number
- 27-4598-01
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral