Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGEX-6P-1
Information
- Source/Vendor
- Amersham
- Alt Name
- pGEX6P1
- Plasmid Type
- Bacterial Expression
- Promoter
- tac
- Cloning Method
- Unknown
- Size
- 4984
- 5' Sequencing 1 Primer
- pGEX Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
- Tag 1
- GST (Nterm)
- Tag 2
- PreScission protease site
- Bacterial Resistance
- Ampicillin
- Notes
- PreScission cleavage site allows cleavage at low temps; can directly insert cDNA from lambda gt11 libraries
- Catalog Number
- 27-4597-01
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral