Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGEX-5X-1
Information
- Source/Vendor
- Amersham
- Plasmid Type
- Bacterial Expression
- Promoter
- tac
- Expression Level
- High (activate with IPTG)
- Cloning Method
- Unknown
- Size
- 4900
- 5' Sequencing 1 Primer
- pGEX Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
- Tag 1
- GST (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Factor Xa cleavage site; can directly insert cDNA from lambda gt11 libraries
- Catalog Number
- 27-4584-01
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral