Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGEX-4T3
Information
- Source/Vendor
- GE Healthcare Life Sciences
- Alt Name
- pGEX-4T-3
- Plasmid Type
- Bacterial Expression
- Promoter
- tac
- Cloning Method
- Unknown
- Size
- 4968
- 5' Sequencing 1 Primer
- pGEX5'
- 5' Sequencing 1 Primer Sequence
- GGGCTGGCAAGCCACGTTTGGTG
- Tag 1
- GST
- Tag 2
- thrombin site
- Bacterial Resistance
- Ampicillin
- Notes
- thrombin or factor Xa protease sites to cleave protein from fusion. pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs. Hosts: E.coli. Related vectors: pGEX-2T. (Information source: <a href=http://seq.yeastgenome.org/vectordb target=_blank>VectorDB</a>.)
- Catalog Number
- 27458301
- GenBank
- M21676, M97937
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified