Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGEM-5Zf (-)
Information
- Source/Vendor
- Promega
- Alt Name
- pGEM5, pGEM5Z, pGEM5Zf
- Plasmid Type
- Bacterial Expression
- Cloning Method
- Unknown
- Size
- 3001
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Bacterial Resistance
- Ampicillin
- Notes
- Derived from the pGEM-3Zf(+) Vector and contain the origin of replication of the filamentous phage f1;Blue white Screening
- Catalog Number
- P2241; P2351
- GenBank
- X65309
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral