Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-50b(+)
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 6733
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- Nus (Nterm), His (Nterm), S-Tag (Cterm)
- Bacterial Resistance
- Kanamycin
- Notes
- Same as pET47 but also has Nterm Nus Tag; contains HRV 3C Protease cleavage site for fusion tag removal at low temperatures; Cterm thrombin cleavage site
- Catalog Number
- 71464-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral