Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-42 c(+)
Information
- Source/Vendor
- EMD Biosciences
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5900
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- GST (Nterm), His (Nterm and Cterm)
- Bacterial Resistance
- Kanamycin
- Notes
- Encodes GST fusion tag; Nterm thrombin cleavage site; Nterm Factor Xa cleavage site; a,b,c vary by MCS
- Catalog Number
- 70561-3, 70562-3, 70563-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral