Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-39b(+)
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Plasmid Type
- Bacterial Expression
- Promoter
- T7
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 6106
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- DsbA, His (Nterm and Cterm), S-Tag (Cterm)
- Bacterial Resistance
- Kanamycin
- Notes
- Encodes Dsb tag for export and periplasmic folding of target proteins Bacterial vector for expressing periplasmic DsbA fusion proteins.
- Catalog Number
- 70090-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral