Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-25b(+)
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pET25b
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR, lac1
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5547
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- His (Cterm), HSV (Cterm)
- Bacterial Resistance
- Ampicillin
- Notes
- PelB sequence for periplasmic localization; same as pET27b but ampR Bacterial vector for expressing proteins in the periplasm.
- Catalog Number
- 69753-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral