Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-21(+)
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pET21
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR, lac1
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5369
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Bacterial Resistance
- Ampicillin
- Notes
- Designed for expression from bacterial translational signal within cloned insert (no ribosome binding site or ATG start codon) Bacterial vector for expressing genes with bacterial translation signals.
- Catalog Number
- 69770-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral