Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET-16b
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pET16b
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR, lac1
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5711
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- 10xHis (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Nterm Factor Xa cleavage site Bacterial vector for expressing 10xHis-tagged proteins.
- Catalog Number
- 69662-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral