Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pET 12 a,b,c
Information
- Source/Vendor
- EMD Biosciences
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 4700
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Bacterial Resistance
- Ampicillin
- Notes
- Nterm ompT sequence for periplasmic export of target protein; a,b,c vary by MCS; a,b,c vary by MCS
- Catalog Number
- 69440-3, 69441-3, 69442-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral