Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pEF1-puro
Information
- Source/Vendor
- Springer lab
- Plasmid Type
- Mammalian Expression
- Promoter
- EF1a
- Cloning Method
- Unknown
- Size
- 7400
- 5' Sequencing 1 Primer
- EF1a-fwd, BGH-rev
- 5' Sequencing 1 Primer Sequence
- TCAAGCCTCAGACAGTGGTTC, TAGAAGGCACAGTCGAGG
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Puromycin
- Notes
- pEF1-puro is derived from pEF1/V5-HisA (Invitrogen) with the neomycin gene replaced with puromycin.
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified