Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pCMV-Myc
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Cloning Method
- Unknown
- Size
- 3800
- 5' Sequencing 1 Primer
- pCMV
- 5' Sequencing 1 Primer Sequence
- 5'd[GATCCGGTACTAGAGGAACTGAAAAAC]3'
- Tag 1
- Myc (N-term) (MASMQKLISEEDL)
- Bacterial Resistance
- Ampicillin
- Notes
- Vector for expressing an N-terminally Myc-tagged protein in mammalian cells.
- Catalog Number
- 631604
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral