Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pcDNA6/myc-His C
Information
- Source/Vendor
- Invitrogen
- Alt Name
- pcDNA™6/myc-H, pcDNA 6/myc-His Ais A
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5122
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- 5' Terminal
- C-Term
- 5' Terminal 2
- C-Term
- Tag 1
- 6xHis
- Tag 2
- Myc
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Blasticidin
- Notes
- Vector for expressing C-terminally Myc- and 6xHis-tagged proteins in mammalian cells.
- Catalog Number
- V22120
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral