Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pcDNA6.2/V5-GW/Directional TOPO
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5162
- 5' Sequencing 1 Primer
- CMVPro Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- V5
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Blasticidin or Neomycin (depends on which vector you have)
- Notes
- Easy to clone into other vectors. Sequence and map shown are for version of vector with Blasticidin resistance.
- Catalog Number
- K2460-20
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral