Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pBudCE4.1
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV or EF-1a
- Cloning Method
- Unknown
- Size
- 4595
- 5' Sequencing 1 Primer
- CMVPro Fwd, EF1aPro Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3', 5'd[TCAAGCCTCAGACAGTGGTTC]3'
- Bacterial Resistance
- Other
- Selectable Marker
- Zeocin
- Notes
- Dual expression in one plasmid
- Catalog Number
- V53220
- Stable
- Unspecified
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral