Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pBAD-DEST 49 Gateway
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Bacterial Expression
- Promoter
- araBAD
- Expression Level
- Tightly controlled
- Cloning Method
- Unknown
- 5' Sequencing 1 Primer
- pBad Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[ATGCCATAGCATTTTTATCC]3'
- Tag 1
- 6X His, V5
- Bacterial Resistance
- Ampicillin
- Notes
- Okay to use with Top10 OneShot comp cells
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral