...μg/mL polybrene. TIP: Polybrene increases the efficiency of viral infection. However, polybrene is toxic...drives RNA Polymerase III transcription for generation of shRNA transcripts. cPPT Central polypurine tract,...especially repeated Ts because polyT is a termination signal for RNA polymerase III. Note that these were ... sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense... for 12-15 hours. c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail .... Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268...Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: ...

... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...

... Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe: -FAM-CACTCCCTCTCTGCGCGCTCG-BBQ...1814040 Microseal adhesive seal, Bio-Rad, MSB1001 Polystyrene Reservoirs, VWR, 89094-662 Microcentrifuge tubes... the NTC. Pour the 1X dilution buffer into a polystyrene reagent reservoir. Using a 20–200 µL multichannel...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...

... ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid... master mix which contains a high-quality DNA polymerase and a blend of dTTP/dUTP to minimize carryover...