...protocol ) Back to Top Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very...advantage of the powerful recombination abilities of yeast. Similar to Gibson, this method can efficiently ...accomplish this, you just need to introduce into the yeast the two (or more) fragments of DNA that you would...be set up to grow, transform and purify DNA from yeast. Back to Top...

...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...

...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...

...engineered using cell-based selection approaches. Yeast-based screening systems resulted in evolved Cas9...SpCas9 variant is identified by in vivo screening in yeast. 2018. Casini A, Olivieri M, Petris G, Montagna ...